ANSWER 2: It is a good idea to have uniformity in what primers are used for drug cassettes. We use the following with good success. For your convenience, you can download this table as a word file called, cassette primers. cassette primers.docx
Drug Cassette | Potential template sources | Primer Pair1 | Expected product size (bp) |
---|---|---|---|
Ampicillin | pBR322 (New England Biolabs) and derivatives | 5'_CATTCAAATATGTATCCGCTC 5'_AGAGTTGGTAGCTCTTGATC |
1202 |
Kanamycin | pBBR1MCS-2 (Kovach et al., 1994), Tn 5 (Ahmed & Podemski, 1995) Note: this is not the same kanamycin gene as in Tn 903. | 5'_TATGGACAGCAAGCGAACCG 5'_TCAGAAGAACTCGTCAAGAAG |
950 |
Chloramphenicol | pACYC184 (New England Biolabs) | 5'_TGTGACGGAAGATCACTTCG 5'_ACCAGCAATAGACATAAGCG |
1011 |
Tetracycline 1: tetA & tetR | Tn 10 (Hillen & Schollmeier, 1983) Note: this is not the same tetracycline gene as in pBR322 or pACYC184. | 5'_CAAGAGGGTCATTATATTTCG 5'_ACTCGACATCTTGGTTACCG |
2016 |
Tetracycline 2: tetA2 | Tn10 (Hillen & Schollmeier, 1983) Note: this is not the same tetracycline gene as in pBR322 or pACYC184. | 5'_CAAGAGGGTCATTATATTTCG 5’_TCCTAATTTTTGTTGACACTCTA |
1313 |
Spectinomycin3 | pBBR1MCS-5 (Kovach et al., 1994), DH5λPRO (Clontech) | 5'_ACCGTGGAAACGGATGAAGG 5'_AGGGCTTATTATGCACGCTTAA |
1229 |
cat-sacB cassette | pK04/pEL04 (Lee et al., 2001) | 5'_TGTGACGGAAGATCACTTCG 5'_ATCAAAGGGAAAACTGTCCATA |
3240 |
amp-sacB cassette | NC398 (Svenningsen et al., 2005) | 5'_CATTCAAATATGTATCCGCTC 5’_ATCAAAGGGAAAACTGTCCAT |
3129 |
tet-sacB cassette | T-SACK (Li et al., 2013) | 5'_TCCTAATTTTTGTTGACACTCTATC 5'_ATCAAAGGGAAAACTGTCCATATGC |
3527 |
1 The melting temperature (TM) of these primer pairs is 58°-62°C. Thus, an annealing temp of 54°C will work for all of them. All primer pairs are designed to include a transcriptional promoter. For some genes, the endogenous promoter and Shine Delgarno sequence (SD) are strong enough that the orf can be replaced directly with the drug resistance orf.
2 Only TetA is required for tetracycline resistance. This set of tet primers makes a smaller cassette than the TetA-TetR dual cassette, but it is unregulated.
3 Using the spectinomycin cassette to knock out genes can be tricky, with the concentration of Spec needed to allow selection and at the same time prevent background growth. This concentration must be determined for each construct and in each strain.
U.S. Department of Health and Human Services | National Institutes of Health | National Cancer Institute | USA.govHome | Contact | Policies | Accessibility | Viewing Files| FOIA | HHS Vulnerability Disclosure