banner image

FAQ 2: What sequences do I use to make a drugR cassette for knock-outs?

ANSWER 2: It is a good idea to have uniformity in what primers are used for drug cassettes. We use the following with good success. For your convenience, you can download this table as a word file called, cassette primers. cassette primers.docx

Drug Cassette Potential template sources Primer Pair1 Expected product size (bp)
Ampicillin pBR322 (New England Biolabs) and derivatives 5'_CATTCAAATATGTATCCGCTC
Kanamycin pBBR1MCS-2 (Kovach et al., 1994), Tn 5 (Ahmed & Podemski, 1995) Note: this is not the same kanamycin gene as in Tn 903. 5'_TATGGACAGCAAGCGAACCG
Chloramphenicol pACYC184 (New England Biolabs) 5'_TGTGACGGAAGATCACTTCG
Tetracycline 1: tetA & tetR Tn 10 (Hillen & Schollmeier, 1983) Note: this is not the same tetracycline gene as in pBR322 or pACYC184. 5'_CAAGAGGGTCATTATATTTCG
Tetracycline 2: tetA2 Tn10 (Hillen & Schollmeier, 1983) Note: this is not the same tetracycline gene as in pBR322 or pACYC184. 5'_CAAGAGGGTCATTATATTTCG
Spectinomycin3 pBBR1MCS-5 (Kovach et al., 1994), DH5λPRO (Clontech) 5'_ACCGTGGAAACGGATGAAGG
cat-sacB cassette pK04/pEL04 (Lee et al., 2001) 5'_TGTGACGGAAGATCACTTCG
amp-sacB cassette NC398 (Svenningsen et al., 2005) 5'_CATTCAAATATGTATCCGCTC
tet-sacB cassette T-SACK (Li et al., 2013) 5'_TCCTAATTTTTGTTGACACTCTATC

1 The melting temperature (TM) of these primer pairs is 58°-62°C. Thus, an annealing temp of 54°C will work for all of them. All primer pairs are designed to include a transcriptional promoter. For some genes, the endogenous promoter and Shine Delgarno sequence (SD) are strong enough that the orf can be replaced directly with the drug resistance orf.

2 Only TetA is required for tetracycline resistance. This set of tet primers makes a smaller cassette than the TetA-TetR dual cassette, but it is unregulated.

3 Using the spectinomycin cassette to knock out genes can be tricky, with the concentration of Spec needed to allow selection and at the same time prevent background growth. This concentration must be determined for each construct and in each strain.